|
ATCC
analyte strain source flu a h3 aichi Analyte Strain Source Flu A H3 Aichi, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/analyte strain source flu a h3 aichi/product/ATCC Average 94 stars, based on 1 article reviews
analyte strain source flu a h3 aichi - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
ATCC
source a baumannii atcc 17978 a baumannii reference strain Source A Baumannii Atcc 17978 A Baumannii Reference Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/source a baumannii atcc 17978 a baumannii reference strain/product/ATCC Average 99 stars, based on 1 article reviews
source a baumannii atcc 17978 a baumannii reference strain - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
resource source identifier bacterial strains mycobacterium tuberculosis strain h37rv atcc atcc 25618 mycobacterium tuberculosis susceptible Resource Source Identifier Bacterial Strains Mycobacterium Tuberculosis Strain H37rv Atcc Atcc 25618 Mycobacterium Tuberculosis Susceptible, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/resource source identifier bacterial strains mycobacterium tuberculosis strain h37rv atcc atcc 25618 mycobacterium tuberculosis susceptible/product/ATCC Average 97 stars, based on 1 article reviews
resource source identifier bacterial strains mycobacterium tuberculosis strain h37rv atcc atcc 25618 mycobacterium tuberculosis susceptible - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
ATCC
225 bacterial strain source pcr qpcr detection vibrio ordalii atcc 33509t atcc 225 Bacterial Strain Source Pcr Qpcr Detection Vibrio Ordalii Atcc 33509t Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/225 bacterial strain source pcr qpcr detection vibrio ordalii atcc 33509t atcc/product/ATCC Average 96 stars, based on 1 article reviews
225 bacterial strain source pcr qpcr detection vibrio ordalii atcc 33509t atcc - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Promega
haeii cut ošx174 dna marker Haeii Cut Ošx174 Dna Marker, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/haeii cut ošx174 dna marker/product/Promega Average 90 stars, based on 1 article reviews
haeii cut ošx174 dna marker - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATCC
strain genotype source nih 444 Strain Genotype Source Nih 444, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/strain genotype source nih 444/product/ATCC Average 94 stars, based on 1 article reviews
strain genotype source nih 444 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
ATCC
haloarchaeon strain source reference haloarcula hispanica atcc 33960 w f Haloarchaeon Strain Source Reference Haloarcula Hispanica Atcc 33960 W F, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/haloarchaeon strain source reference haloarcula hispanica atcc 33960 w f/product/ATCC Average 95 stars, based on 1 article reviews
haloarchaeon strain source reference haloarcula hispanica atcc 33960 w f - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
ATCC
plasmid characteristics † source strains l reuteri atcc pta 6475 human breast milk isolate biogaia l lactis subsp cremoris nz9000 derivative ![]() Plasmid Characteristics † Source Strains L Reuteri Atcc Pta 6475 Human Breast Milk Isolate Biogaia L Lactis Subsp Cremoris Nz9000 Derivative, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid characteristics † source strains l reuteri atcc pta 6475 human breast milk isolate biogaia l lactis subsp cremoris nz9000 derivative/product/ATCC Average 99 stars, based on 1 article reviews
plasmid characteristics † source strains l reuteri atcc pta 6475 human breast milk isolate biogaia l lactis subsp cremoris nz9000 derivative - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
strain source geographic origin reference ![]() Strain Source Geographic Origin Reference, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/strain source geographic origin reference/product/ATCC Average 90 stars, based on 1 article reviews
strain source geographic origin reference - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATCC
source strain ![]() Source Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/source strain/product/ATCC Average 95 stars, based on 1 article reviews
source strain - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s mutans dna source s mutans strain ua159 ![]() Caption A7 Source Organism S Mutans Dna Source S Mutans Strain Ua159, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s mutans dna source s mutans strain ua159/product/ATCC Average 98 stars, based on 1 article reviews
caption a7 source organism s mutans dna source s mutans strain ua159 - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal: Applied and Environmental Microbiology
Article Title: Photobacterium angustum and Photobacterium kishitanii , Psychrotrophic High-Level Histamine-Producing Bacteria Indigenous to Tuna
doi: 10.1128/AEM.02833-15
Figure Lengend Snippet: Photobacterium strains used in this study
Article Snippet: The strains used in this study, including type strains and other strains from national culture collections, are listed in . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Species and
Techniques:
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Crystal structure of the aromatic-amino-acid aminotransferase from Streptococcus mutans
doi: 10.1107/S2053230X18018472
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Macromolecule-production information is summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Cloning, Plasmid Preparation, Expressing, Sequencing, Construct, Produced